Journal cover Journal topic
Archives Animal Breeding Archiv Tierzucht
Journal topic

Journal metrics

Journal metrics

  • IF value: 1.203 IF 1.203
  • IF 5-year value: 1.203 IF 5-year 1.203
  • CiteScore value: 0.98 CiteScore 0.98
  • SNIP value: 0.920 SNIP 0.920
  • SJR value: 0.390 SJR 0.390
  • IPP value: 0.89 IPP 0.89
  • h5-index value: 11 h5-index 11
  • Scimago H index value: 23 Scimago H index 23
Supported by
Logo Leibniz Institute for Farm Animal Biology Logo Leibniz Association
Volume 61, issue 1 | Copyright
Arch. Anim. Breed., 61, 71-78, 2018
https://doi.org/10.5194/aab-61-71-2018
© Author(s) 2018. This work is distributed under
the Creative Commons Attribution 3.0 License.

Original study 02 Feb 2018

Original study | 02 Feb 2018

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Haidong Zhao, Mingli Wu, Shuhui Wang, Xiaohui Yu, Ze Li, Ruihua Dang, and Xiuzhu Sun Haidong Zhao et al.
  • College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P<0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P<0.05). In conclusion, a novel 24bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

Download & links
Download
Short summary
The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect a novel 24 bp indel within the AR gene. It significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.
The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and...
Citation
Share