Journal cover Journal topic
Archives Animal Breeding Archiv Tierzucht

Journal metrics

  • IF value: 0.389 IF 0.389
  • IF 5-year<br/> value: 0.500 IF 5-year
    0.500
  • CiteScore<br/> value: 0.59 CiteScore
    0.59
  • SNIP value: 0.685 SNIP 0.685
  • SJR value: 0.353 SJR 0.353
  • IPP value: 0.657 IPP 0.657
  • h5-index value: 9 h5-index 9
Supported by
Logo Leibniz Institute for Farm Animal Biology Logo Leibniz Association
Arch. Anim. Breed., 61, 71-78, 2018
https://doi.org/10.5194/aab-61-71-2018
© Author(s) 2018. This work is distributed under
the Creative Commons Attribution 3.0 License.
Original study
02 Feb 2018
Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds
Haidong Zhao, Mingli Wu, Shuhui Wang, Xiaohui Yu, Ze Li, Ruihua Dang, and Xiuzhu Sun College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China
Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05). In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

Citation: Zhao, H., Wu, M., Wang, S., Yu, X., Li, Z., Dang, R., and Sun, X.: Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds, Arch. Anim. Breed., 61, 71-78, https://doi.org/10.5194/aab-61-71-2018, 2018.
Download
Short summary
The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect a novel 24 bp indel within the AR gene. It significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.
The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and...
Share