The effect of short/branched chain acyl-coenzyme A dehydrogenase gene on triglyceride synthesis of bovine mammary epithelial cells

2.1 Expression of ACADSB gene in various bovine mammary tissues

In this study, 3 high milk fat cattle and 3 low milk fat cattle were chosen by a milk ingredient analyzer (Lactoscan SP, Milkatronic Ltd., Nova Zagora, Bulgaria) from 15 healthy dairy cattle, which were in the same environment and the same lactation period. Dairy cattle of different experimental groups were slaughtered at Haoyue slaughterhouse in Changchun, and then the fresh breast tissues were collected from the carcass of dairy cattle with different milk fat percentage and frozen in liquid nitrogen for subsequent experiments. The total RNA was extracted from mammary tissue using TRIzol Reagent (Tiangen, Beijing, China) and reverse transcribed into cDNA using a RT cDNA synthesis kit (TOYOBO, Japan) and following the manufacturer's protocols. ACADSB gene expression in mammary tissues from cattle with different milk fat percentages was analyzed by quantitative real-time fluorescent PCR (qRT-PCR). The qRT-PCR was carried out using SYBR^® Premix Ex taq^TM (TAKARA). PCR amplification cycles for standard curve were performed as follows: 95 ^∘C for 5 min; 40 cycles of 95 ^∘C for 30 s and 60 ^∘C for 30 s.

2.2 Construction of interference vector pGPU6/GFP/Neo-ACADSB

A 21-mer siRNA oligonucleotide targeting the coding sequence of ACADSB and the complementary oligonucleotide were designed according to the design principles of shRNA. The target sequence on ACADSB gene is GCTGGGTATAAAGGAA TTACC and the sequences of the primer pair were as follows: (5^′-CACCGCTGGGTATAAA GGAATTACCTTCAAGAGAGGTAATTCCTTTATACCC AGCTTTTTTG-3^′) and (5^′-GATCCAAAAAAGCTGGGTATAAAGGAATTA CCTCTCTTGAAGGTAATTC CTTTATACCCAGC-3^′). Annealed siRNA oligonucleotides were cloned into pGPU6/GFP/Neo vector (GenePharma Corporation, Shanghai). The 10 µL annealing mixture was as follows: 1 µL annealing buffer, 1 µL sense siRNA template oligonucleotide (100 µM), and 1 µL antisense siRNA template oligonucleotide (100 µM), 7 µL ddH₂O.

Negative control plasmid was constructed by inserting annealed scrambled siRNA oligonucleotides into pGPU6/GFP/Neo.

2.3 Construction of overexpression vector pBI-CMV3-ACADSB

The cDNA for the predicted mature coding region of ACADSB in cow was amplified by PCR with sense primer 5^′-GGATCCATGGAGCGAGCTACTGTT CGG-3^′ containing a BamHI site and antisense primer 5^′-ATCGATTCAGTATTCCGC ACTGATGCAC-3^′ containing a ClaI site. The 1299 bp PCR products were purified and ligated into pMD18-T simple vector (TAKARA, Beijing, China). The ACADSB sequence that includes cleavage sites of BamHI and ClaI restriction enzyme was ligated into the expression vector of pBI-CMV3. The resultant plasmid, pBI-CMV3-ACADSB, was confirmed by double restriction enzyme digestion with BamHI (NEB, UK) and ClaI (NEB, UK), and further validated with sequencing by Shanghai Sangon Biotech.

2.4 Transfection of plasmids into bovine mammary epithelial cells

The bovine mammary epithelial cells in this study were established by our laboratory (Lu et al., 2012). Cells were cultured in 10 cm culture plates (Falcon, Franklin, Lake, NJ, USA) in DMEM/F12 (HyClone, USA) with 10 % FBS (fetal bovine serum, Invitrogen, USA), 50 µL hydrocortisone (50 µg mL⁻¹, Abcam, UK) and 50 µL insulin (0.5 EU mg⁻¹, Abcam, UK) with 1 % antibiotics (HyClone). Then, bMECs were seeded into six well-culture plates (Falcon, Franklin, Lake, NJ, USA) at a concentration of 0.6 × 10⁶ cells/well and cultured at 37 ^∘C in CO₂ incubator (Thermo, Marietta, OH, USA). When cells reached at 70 % confluency, cells changed the medium without antibiotics for transfection. Plasmid DNA was transfected into bMECs using FuGENE^® HD Transfection Reagent (Promega, USA) according to the manufacturer's instructions. The expression of GFP in transfected cells was observed under a fluorescence microscope (NikonTE2000, Japan) after transfection for 24 h. The transfected cells groups included overexpression group (pBI-CMV3-ACADSB plasmid and pBI-CMV3 control plasmid) and RNAi group (pGPU6/GFP/Neo-ACADSB plasmid and pGPU6/GFP/Neo-shNC control plasmid).

2.5 Analysis of ACADSB expression by quantitative RT-PCR

BMECs transfected with ACADSB RNAi vector and overexpression vector were harvested after transfection for 24 h, and total RNA was extracted using the PREP RNA mini kit (Analytik Jena, Germany). Total RNA was checked with agarose gel electrophoresis, and the concentration was measured using a spectrophotometer. The cDNA was synthesized using a RT cDNA synthesis kit (ToYoBo, Japan) following the manufacturer's protocols. The qRT-PCR was carried out using SYBR^® Premix Ex taq^TM (TAKARA) and a pair of specific primers ACADSB-F: 5^′AGCTACTGTTCGGCTGCTGC 3^′, and ACADSB-R: 5^′TCCATTGCTTGTCG CTTTGAG 3^′. The mRNA expression level was determined by qPCR, and β-actin was served as the reference gene. The relative expression levels of ACADSB mRNA were calculated by 2^−ΔΔct method, and the experiment was repeated three times.

2.6 Analysis of ACADSB protein expression by Western blot

The cells were collected after transfection for 48 h and washed two times with PBS (phosphate buffered saline). Cells were then resuspended in RIPA buffer (RIPA splitting buffer, BOSTER, China) with protease inhibitor. Cell lysates were cleared by centrifugation at 12 000 g for 5 min at 4 ^∘C, and then the supernatants were collected. The total protein concentration in the samples was determined with the enhanced BCA protein quantitation assay (KeyGEN BioTECH, China) by a spectrophotometer (UNIC2802H, Shanghai, China). For Western blot, equal amounts of various proteins were resolved by SDS-PAGE and then transferred onto PVDF membranes (Bio-Red laboratories Inc, USA) by a trans-blot (SEMI-DRY TRANSFER CELL, BIO-RAD, USA) for 8 min. After blocked with 1 × TBS buffer containing 5 % BSA (bovine serum albumin) for 3 h, the PVDF membrane was washed with TBST solution. Membrane was then incubated with rabbit polyclonal anti-ACADSB antibody (dilution in 1 × TBS, 1:750 Abcam, USA) and β-actin (dilution in 1 × TBS, 1:10 000 Abcam, USA) for 12 h at 4^∘. After washing with TBST, membrane was incubated with anti-rabbit secondary antibody (dilution in 1× TBS, 1:2000, BioWorld, USA) for 2 h. The protein bands were visualized with an enhanced chemiluminescent HRP substrate (Thermo, USA). The relative expressions of target protein in different samples were calculated with the gray value analyzer.

2.7 Determination of the triglyceride content in transfected cells

The TG contents were determined using TG kit (Applygen Technologies, Beijing, China) according to the manufacturer's protocols. BME cells were plated at a concentration of 0.6 × 10⁶ cells/well on six-well plates (Falcon, Franklin Lakes, NJ, USA), and the cells were collected after transfection for 48 h with CMV3-ACADSB and pGPU6/GFP/Neo-ACADSB plasmid. Different samples were adjusted to the same concentration, and each sample was repeated three times. Cellular content of TG was adjusted based on the quantity of protein. Total protein concentration was estimated by the BCA protein content detection kit (KeyGen, Biotech, China), and the cellular content of TG was corrected for protein concentration of each microgram. The concentration of TG was determined by a microplate reader (Yong Chuang SM600, Shanghai, China).

2.8 Statistical analysis

Experimental data are shown as mean ± SE. Statistically significant differences are defined as p<0.05. Data from fluorescence quantitative PCR on relative gene expression were analyzed using the comparative Ct method (2^−ΔΔCt). Data analysis was performed with SPSS 13.0 software and GraphPad Prism 5 software (GraphPad Software, San Diego, CA, USA) using a two-tailed t test (unpaired t test).

3.1 ACADSB expression in various bovine mammary tissues

Cattle short/branched chain acyl-CoA dehydrogenase gene is located on bovine (BTA) chromosome 26 (26:43 134 415–43 184 345). The ACADSB DNA sequence contains 49 930 base pairs, 11 exons and 10 introns (Fig. 2a). ACADSB mRNA sequence contains a 1299 bp coding region (CDS) and a 559 bp 5^′, 3^′ UTR. The ORF is encoded for a 432-amino-acid protein.

The ACADSB gene expression in mammary tissues from the three high milk fat cattle and three low milk fat cattle was determined by quantitative real-time PCR. The expression of ACADSB gene in mammary tissues of high milk fat cattle is significantly higher than that in the low milk fat cattle (p<0.05, Fig. 1, Table 2).

Figure 1The ACADSB gene expression levels in mammary tissue of high milk fat and low milk fat cattle.

Download

Figure 2Construction of ACADSB gene RNA interference and overexpression vector and transfection into bovine mammary epithelial cells.(A) Bovine ACADSB gene location and structure features. (B) Primer sequence and vector of ACADSB gene. (i) Primer sequence of RNA interference target sequence and interference vector (pGPU6/GFP/Neo-ACADSB). (ii) Primer sequence of ORF and overexpression vector (pBI-CMV3-ACADSB). (C) Plasmid transfection into bovine mammary epithelial cells (A-1) cells transfected with ACADSB RNAi plasmid pGPU6/GFP/Neo-ACADSB, B-1: cells transfected with pGPU6/GFP/Neo control plasmid, C-1: cells transfected with ACADSB overexpression plasmid pBI-CMV3-ACADSB, D-1: cells transfected with pBI-CMV3 control vector. (D) mRNA and protein of ACADSB expression in bovine mammary epithelial cells that transfected with RNAi and overexpression plasmid. (i-a): ACADSB mRNA expression in bMECs that transfected with RNAi plasmid; (i-b): ACADSB protein expression in bMECs that transfected with RNAi plasmid; (ii-a): ACADSB mRNA expression in bMECs that transfected with overexpression plasmid; (ii-b): ACADSB protein expression in bMECs that transfected with overexpression plasmid (the protein expression level of ACADSB using gray value analyzer to calculate gray value ratios (target protein content/β-actin content).

Download

Table 2The milk fat percentage data were obtained from a total of 15 Chinese Holstein dairy cattle 10 days continuously.

^a low milk fat percentage dairy cattle
^b high milk fat percentage dairy cattle

Download Print Version | Download XLSX

3.2 Transfection of plasmids into bovine mammary epithelial cells

In order to reveal the effect of ACADSB gene on the synthesis of TGs, overexpression vector and RNAi vector of bovine ACADSB gene were successfully constructed (Fig. 2b). Bovine mammary epithelial cells were transiently transfected with plasmids of pGPU6/GFP/Neo-ACADSB and pBI-CMV3-ACADSB. The expression of green fluorescence could be observed from both overexpression vector (pBI-CMV3-ACADSB) transfected group and RNAi vector (pGPU6/GFP/Neo-ACADSB) transfected group after 24 h transfection but not in untransfected group (Fig. 2c).

3.3 Analysis of ACADSB mRNA expression in transfected group by qRT-PCR

To investigate the effect of pBI-CMV3-ACADSB and pGPU6/GFP/Neo-ACADSB vector on cellular ACADSB mRNA level, total RNA was extracted from cells which transfected with various plasmids and analyzed by qRT-PCR. The results showed that ACADSB mRNA expression levels in RNAi transfected cells were significantly decreased compared with those in the negative control vector transfected cells (p<0.05, Fig. 2D(i)–(a)). In the meantime, the ACADSB mRNA expression levels in overexpression transfected cells were significantly increased compared with those in the control vector transfected cells (p<0.01, Fig. 2D(ii)–(a)).

3.4 Expression of ACADSB protein in bMEC transfected with different plasmid

To investigate the effect of pBI-CMV3-ACADSB and pGPU6/GFP/Neo-ACADSB plasmid on cellular ACADSB protein level, total protein was isolated from cells that transfected with various plasmids of overexpression vector and RNAi vector. The Western blot analysis results revealed that ACADSB protein expression in RNAi transfected cells was significantly down-regulated compared to those in the negative control vector transfected cells (p<0.05, Fig. 2D(i)–(b)). Meanwhile, the protein level of ACADSB was significant increased in pBI-CMV3-ACADSB vector transfected group compared with that in the control vector transfected group (p<0.05, Fig. 2D(ii)–(b)). β-actin was used as an internal control. Western blot protein bands were digitized with a gray value analyzer, and ACADSB protein level was expressed as the ratio over β-actin.

3.5 Detection of the triglyceride content in bMEC transfected with different plasmid

To examine the effect of ACADSB gene on intracellular TG synthesis, TG content was detected by TG kit. The result showed that TG content in bMEC transfected with pGPU6/GFP/Neo-ACADSB was significantly lower than that in the control group and pBI-CMV3-ACADSB transfected group (p<0.05, Fig. 3a). Meanwhile, the TG content in bMEC transfected with overexpression vector was significantly higher compared to that in the control vector transfected group (p<0.05, Fig. 3b).

Figure 3Comparison of the TG content of bMECs which transfected with RNAi vector or overexpression vector. (a) The TG content of bMECs which transfected with pGPU6/GFP/Neo-ACADSB vector and pGPU6/GFP/Neo control vector. (b) The TG content of bMECs which transfected with overexpression plasmid pBI-CMV3-ACADSB and pBI-CMV3 control vector.

Download