AABArchives Animal BreedingAABArch. Anim. Breed.2363-9822Copernicus PublicationsGöttingen, Germany10.5194/aab-60-79-2017A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its
influence on growth traits in four sheep breeds of various fecundityZhaoHaidongHeShuaiZhuYanjiaoCaoXinLuoRenyunCaiYongXuHongweixuhongwei@xbmu.edu.cnSunXiuzhusunxiuzhu208@163.comCollege of Animal Science and Technology, Northwest A&F
University, Yangling, Shaanxi, 712100, P. R. ChinaScience Experimental Center, Northwest University for
Nationalities, Lanzhou, Gansu, 730030, P. R. ChinaRuilin Sci-Tech Culture and Breeding Limit Company, Yongjing,
Gansu, 731600, P. R. ChinaCollege of Life Science and Engineering, Northwest University for
Nationalities, Lanzhou, Gansu, 730030, P. R. ChinaHongwei Xu (xuhongwei@xbmu.edu.cn) and Xiuzhu Sun (sunxiuzhu208@163.com)27April2017602798511December201614March201723March2017This work is licensed under a Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by/3.0/This article is available from https://aab.copernicus.org/articles/60/79/2017/aab-60-79-2017.htmlThe full text article is available as a PDF file from https://aab.copernicus.org/articles/60/79/2017/aab-60-79-2017.pdf
Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key
transcription factors in animal growth and reproduction. Insertion/deletion
(indel) is a relatively simple and effective DNA marker. Therefore, four sheep
breeds of various fecundity were used to explore the novel indel variants
within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth
traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep
LHX3 gene was found, and three genotypes were detected. Interestingly, the
increasing trends of II (insertion/insertion) genotype frequency and I
allelic frequency were the same as the growth of the fertility character. Genotypic
frequency and allelic frequency distributions were significantly different
between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity
breed (TS) based on a χ2 test (P < 0.05). Association
analyses showed that body length was significantly different in female TS
and STHS and that chest width was significantly different for the female TS and
male STHS (P < 0.05). These findings suggested that the 29 bp indel
could extend the spectrum of genetic variations of the LHX3 gene in sheep and
provide a valuable theoretical basis for the marker-assisted selection (MAS)
in sheep breeding and genetics.
Introduction
The Tong sheep (TS) is a well-known indigenous sheep breed in China, and it has
more than 1200 years of history according to research. The breed is mainly
found in Baishui County, Shaanxi Province. TS possess many valuable
genetic resources, such as high-quality semi-fine wool, low-odor mutton, large, fat tails and valuable
pelts. These genetic
resources in the sheep gene bank are valuable not only in China but also globally.
However, owing to the characteristics of slow growth and low fecundity, TS
have been in danger of becoming extinct in Shaanxi Province.
PCR primer sequences of the sheep LHX3 and LHX4 genes.
NamePrimer sequences (5′–3′)Tm (∘C)ProductNotessize(bp)LHX3-P1F: CTCTGAACTGCCAGGACCCATD-PCR280Pool DNA sequencing/R: ACTCCACGATGCAGCCAAGAindel classificationLHX3-P2F: CACTTTCCGGGCGAAGTCAGTD-PCR299Pool DNA sequencingR: GAAGTAGGAGACGGAGGAGACCCLHX3-P3F: GCAGACTACGAGACAGCCAAGCTD-PCR255Pool DNA sequencingR: CTGCTAACTGTCCCCTCCATCTCLHX3-P4F: CCAAGCCAGCCAGGGACGATD-PCR180Pool DNA sequencingR: GCCCAGAGCCTTGAGGGTGAALHX4-P1F: CACAACTCCAGGGGCATCTD-PCR264Pool DNA sequencingR: CCACAGAGTACAACCTTCCAACLHX4-P2F: CCCCAACACCTCAAACCTCTTTD-PCR294Pool DNA sequencingR: TCCGATGTAGGCATGGGAACLHX4-P3F: GGAGGAAAGTGTCAACTGGGTD-PCR294Pool DNA sequencingR: AGCAATAGACGGCGGAGCLHX4-P4F: GGGCGGTCTCGAAGGACGGATD-PCR286Pool DNA sequencingR: GCGCTTCCCAGCCCTTGCTC
It is well known that the pituitary gland is the center of the regulating animal
growth and reproduction (Hong et al., 2016). Interestingly, there are many
prehypophyseal cells resulting from secretion of different hormones to regulate the
target organs, including adrenocorticotropic hormone (ACTH),
follicle-stimulating hormone (FSH), luteinizing hormone (LH), thyroid
stimulating hormone (TSH), growth hormone (GH), and prolactin (PRL).
Most of them had a certain contact with animal growth and reproduction.
However, some inducing signals and transcription factors play an important role
in the development of the pituitary gland itself, such as LIM homeobox gene 3
(LHX3) and LIM homeobox gene 4 (LHX4) (Park et al., 2013; Voorbij et al., 2015;
Yoshida et al., 2016). LHX3 and LHX4 are important members of the LIM homeobox
family, whose characteristics of the encoded protein include a rich cysteine zinc
finger structure. These genes are the most important regulatory factors upstream of the
pituitary gland, able to transform expression of GH and PRL directly, as well
as adjust the expression level of the POU1F1 gene to influence the other regulators
(Colvin et al., 2011; Malik and Rhodes, 2014; Seo et al., 2015).
Compared to traditional breeding, molecular breeding has the advantage of
saving time and decreasing expenses. During the past decades,
insertion/deletion (indel) has become increasingly popular in animal
breeding for marker-assisted selection (MAS), and especially exists in
eukaryotic genomes (Tian et al., 2008; Yang et al., 2016). In this current study, indel is one of the most important raw materials of evolution and breeding in genomic DNA. According to previous studies,
indel accumulation is an important reason for differences in gene
expression (Williams and Wernegreen, 2013; Ashkenazy et al., 2014). For the reasons
given above, Lanzhou fat-tail Han sheep (LFTS), small-tail Han sheep (STHS)
and Hu sheep (HS) were compared with TS to explore the potential indel on
LHX3 and LHX4 (Song et al., 2012; Zhang et al., 2014; Huang et al., 2015; Miao et
al., 2015). In addition, the indel of sheep on the LHX3 and LHX4 genes associated with growth
traits is limited.
Therefore, the objective of this study was to explore the novel indel
variants within the sheep LHX3 and LHX4 genes, as well as to evaluate their effects on
growth traits in four Chinese indigenous sheep breeds of various fecundity – not
only to extend the spectrum of genetic variations of the sheep LHX3 and LHX4 genes but
also to contribute to implementing MAS in genetics and breeding in sheep.
Material and methods
All experiments performed in this study were approved by the International
Animal Care and Use Committee of the Northwest A&F University
(IACUC-NWAFU). Furthermore, the care and use of animals completely complied
with local animal welfare laws, guidelines, and policies.
DNA samples and data collection
A total of 606 sheep (2–6 years old) were used in
this study. These were of four breeds with different fecundity, including Hu sheep (HS, n= 179, Mengjin County, Henan Province),
small-tail Han sheep (STHS, n= 195, Yongjing County, Gansu Province),
Lanzhou fat-tail sheep (LFTS, n= 67, Yongjing County, Gansu Province) and
Tong sheep (TS, n= 165, Baishui County, Shaanxi Province). Growth traits for all healthy and unrelated individuals were
measured by the same person and using same standard, including body weight (BW),
body height (BH), body length (BL), chest circumference (ChC), chest depth
(ChD), chest width (ChW), hucklebone width (HuW), hip width (HW) and cannon
circumference (CaC); consequently, body length index (BLI), chest
circumference index (ChCI), chest width index (ChWI), cannon circumference
index (CaCI), hucklebone width index (HuWI) and trunk index (TI) were also
calculated on the basis of a related reported description (Lan et al., 2007, 2013; Jia et al., 2015).
DNA isolation and genomic DNA pool construction
DNA samples were extracted from ear tissue and leukocytes of blood by means
of the phenol–chloroform method (Zhang et al., 2015a, b). Quality of DNA samples
was assayed with a Nanodrop 1000 (Thermo Scientific, Waltham, MA, USA), diluted
to 10 ng µL-1. Considering workloads and that the lower frequency of indel could be found by agarose gel electrophoresis, every 25th sample was used to construct a genomic DNA pool for
polymerase chain reaction (PCR) to find the potential indel locus in the sheep
LHX3 and LHX4 gene (Lan et al., 2013; Chen et al., 2016).
Primer design and PCR amplification
Based on the single nucleotide polymorphism (SNP) database from NCBI (https://www.ncbi.nlm.nih.gov/snp), eight indel
potential sites were found on the sheep LHX3 and LHX4 introns, which were designed by
Primer Premier software 5.0 (Premier Biosoft International USA) based on the
sheep LHX3 and LHX4 gene sequence (GenBank NC_ 019460.1) (Table 1). After
touch-down PCR, the products were detected by electrophoresis of 2.5 %
agarose gel stained with GelRed (Solarbio Life Science, China); the products
were sequenced only when they had different genotypes for each pair of
primers (Zhang et al., 2015a; Yang et al., 2016).
Statistical analyses
Sequences were contrasted and analyzed with BioEdit, using the website
www.Msrcall.com to calculate and analyze the genetic data of
Hardy–Weinberg equilibrium (HWE), homozygosity (Ho), heterozygosity (He),
effective allele numbers (Ne), and polymorphism information content (PIC) (Li et
al., 2009). For the χ2 test between varieties and analysis of variance (ANOVA) in
varieties, SPSS software (version 18.0) (IBM, USA) for Windows was used. Statistical testing was carried out
on the results (Pan
et al., 2013).
The agarose gel (2.5 %) electrophoresis patterns of the 29 bp indel within
the sheep LHX3 gene. PCR products showed two genotypes at this locus, where the
insertion/insertion type (II genotype) consisted of 280 bp,
deletion/deletion types (DD genotype) consisted of 251 bp, and the
heterozygote type (ID genotype) showed 280 and 251 bp.
Sequencing maps for the 29 bp indel in the sheep LHX3 gene. (a) Homozygotic
insertion type (II); the sequence with the black border is 29 bp
deletion. (b) Homozygotic deletion type (DD).
Genotypes, alleles, He, Ne, and PIC for the novel indel of the
sheep LHX3 gene.
Note: N, number; HWE, Hardy–Weinberg equilibrium; Ho, homozygosity;
He, heterozygosity; Ne, effective allele numbers; PIC, polymorphism information
content.
Results
Through the detection of DNA pools and individuals, no polymorphism was
found in the LHX4 gene, while only one novel indel was found in the LHX3 gene. Next, using
the 2.5 % agarose gel detection, a 29 bp difference in the sheep LHX3 gene showed
three types of bands after 40 min (Fig. 1) – that is,
insertion/insertion (II) showed one band (280 bp) and the deletion/deletion (DD)
type displayed one band (251 bp), whereas the insertion/deletion (ID) type showed two
bands (280, 251 bp). Figure 2 shows that the del portion is “GGCCTGGACTGTGATGGGCACCCTCCGGG” by means of PCR product sequencing, which mixed the same samples; this result is the same as the prediction of the sheep LHX3 gene from the NCBI
database (NC_019460 g.3107494-3107522).
As can be seen in Table 2, the genotype frequencies and allelic
frequencies of 29 bp indel within the sheep LHX3 gene in four breeds (HS, STHS, LFTS and
TS) were evaluated. The four breeds all belong to a moderate polymorphic locus.
Homozygosity (Ho) was very close to heterozygosity (He), and effective allele
numbers (Ne) were nearly 2. Interestingly, the major II genotype frequency
and I allelic frequency increasing trend are the same as fecundity growth (Fig. 3). For current locus, both the HS and TS were at Hardy–Weinberg equilibrium
(HWE) (P > 0.05).
Genotypic and allelic frequencies of the 29 bp indel locus
within the LHX3 gene in the four sheep breeds;
∗∗ represents p < 0.01.
χ2 test of different breeds on novel indel of the
sheep LHX3 gene.
Notes: HS, Hu sheep; STHS, small-tail Han sheep; LFTS, Lanzhou fat-tail
sheep; TS, Tong sheep.
Genotypic frequency distributions were significantly different between the
higher-fertility breeds (HS, STHS, LFTS) and the low-fertility breed (TS) based
on a χ2 test (P < 0.01). The results of the χ2 test on
allelic frequency showed that its distribution between the high-fertility breeds (HS,
STHS, LFTS) and the low-fertility breed (TS) was the same as the previous
conclusion (P < 0.05) (Table 3).
Relationship between the novel 29 bp indel of the sheep LHX3 gene
and growth traits in Tong sheep and small-tail Han sheep.
Notes: TS, Tong sheep; STHS, small-tail Han sheep; LSM, least-squares method;
SE, standard error; n, number. a,b=p<0.05.
The associations between the 29 bp indel and the sheep growth traits were
investigated. Significant differences were found between different genotypes
and female body length in TS and STHS (P < 0.05). Additionally,
significant differences were found between different genotypes and chest
width in female TS and male STHS (P < 0.05) (Table 4). Moreover, the
indel loci also have approximately significant effects on some traits such as
chest circumference in LFTS (P= 0.08) and sacrum height in STHS
(P= 0.07). In addition, there was no significant relationship between each of the growth
traits.
Discussion
Animal growth and development are an extremely complex process, containing a variety of mechanisms with many regulatory factors. It is very
important to have great knowledge of the gene structure and function for regulation of growth
and development. Recent studies have focused on genetic variations within the
LHX3 gene in bovines and goats, among which a number of SNP sites were found which
could impact growth and milk traits (Jing et al., 2008; Liu et al., 2011;
Jin et al., 2016; Zhang et al., 2016). Herein, we firstly confirmed a novel
29 bp indel (NC_019460:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the intron
of the sheep LHX3 gene in four indigenous sheep breeds. This is consistent with what is predicted from NCBI SNP database.
As shown in Fig. 3 and Table 2, it was found that the I allelic and II
genotype between the high-fertility breeds (HS, STHS and LFTS) and the low-fertility
breed (TS) had significant difference in the χ2 test. This
situation showed remarkable consistency, implying that there is a certain
correlation between fertility and this indel locus.
In consideration of the important function of LHX3 on animal growth and
reproduction, the associations between the 29 bp indel and the sheep growth
traits were also analyzed. An interesting phenomenon was found in Tong sheep
body length and chest width growth traits: the individuals with the II genotype
showed superior traits, and the individuals with the homozygote II genotype were
significantly better than those with the ID genotype; that is, the II
genotype was the most conducive to growth in Tong sheep, which was a
potential genetic marker used to improve Tong sheep breeding (Tepaamorndech
et al., 2014; Rodrigues et al., 2015). In fact, many studies have also
reported that the indel within critical genes was associated with growth traits in
livestock. In addition, the best genotypes of chest width within different
breeds and sex were not the same; the causes of this phenomenon
could be the differences between varieties and sex-specific effects on LHX3 (Savage
et al., 2007). Despite this locus being located in the introns, many studies have demonstrated that the indel could affect the expression of target gene through many channels. For example, a 2 bp indel within the Kruppel-like factor 15 gene
(KLF15) influences chicken growth and carcass traits (Lyu et al., 2014).
At the same time, according to the classification of polymorphism
information content (PIC) and Hardy–Weinberg equilibrium (HWE) in Table 2,
the 29 bp indel was identified as mediating polymorphism in all analyzed
breeds. That is to say, the 29 bp indel was characterized by abundant
genetic diversity, suggesting that this locus could be used for assessing
sheep genetic resources. The P values of HWE in STHS and LFTS sheep breeds
were less than 0.05; the causes of this situation were the lack of
population and artificial selection.
Briefly, a novel 29 bp indel within the LHX3 gene significantly affected growth
traits, suggesting that this indel is a potentially useful DNA marker for
eliminating or selecting excellent individuals in MAS breeding in relation
to growth traits in sheep.
Conclusion
Our results confirmed the existence of the 29 bp indel within the intron of the LHX3 gene in
four Chinese indigenous sheep breeds. In addition, they verified significant association
with growth traits in four sheep breeds.
The original data are available upon request from the corresponding author.
Xiuzhu Sun and
Hongwei Xu designed experiments; Haidong Zhao, Shuai He, Xin Cao, Yong Cai
and Renyun Luo collected DNA samples; Haidong Zhao and Shuai He carried out
experiments; Haidong Zhao, Shuai He and Yanjiao Zhu analyzed experiments;
Xiuzhu Sun and Haidong Zhao wrote the manuscript.
The authors declare that they have no conflict of interest.
Acknowledgements
This work was supported by the Fundamental Research Funds for the Central
Universities (2014YB003). We greatly thank the staff of Tong sheep elite
reservation farm, Baishui County, Shannxi Province, and Ruilin Sci-Tech
Culture and Breeding Limit Company Yongjing County, Gansu Province, and
Shanshan agriculture and animal husbandry Sci-tech company Mengjin County,
Henan Province, for collecting samples.
Edited by: S. Maak
Reviewed by: two anonymous referees
References
Ashkenazy, H., Cohen, O., Pupko, T., and Huchon, D.: Indel reliability in
indel-based phylogenetic inference, Genome Bio. Evol., 6, 3199–3209, 2014.Chen, R., Yu, S., Ren, F., Lv, X. Y., and Pan, C. Y.: Detection of one large
insertion/deletion (indel) and two novel SNPs within the SPEF2 gene
and their associations with male piglet reproduction traits, Arch. Anim.
Breed., 59, 275–283, 10.5194/aab-59-275-2016, 2016.
Colvin, S. C., Malik, R. E., Showalter, A. D., Sloop, K. W., and Rhodes, S.
J.: Model of pediatric pituitary hormone deficiency separates the endocrine
and neural functions of the LHX3 transcription factor in vivo, P. Natl. Acad.
Sci. USA, 108, 173–178, 2011.
Hong, G. K., Payne, S. C., and Jane, J. A.: Anatomy, physiology, and
laboratory evaluation of the pituitary gland, Otolaryngol Clin. North Am.,
49, 21–32, 2016.Huang, Y. Z., Jing, Y. J., Sun, Y. J., Lan, X. Y., Zhang, C. L., Song, E. L.,
and Chen, H.: Exploring genotype-phenotype relationships of the LHX3
gene on growth traits in beef cattle, Gene, 561, 219–224, 2015.
Jia, W. C., Wu, X. F., Li, X. C., Xia, T., Lei, C. Z., Chen, H., Pan, C. Y.,
and Lan, X. Y.: Novel genetic variants associated with mRNA expression of
signal transducer and activator of transcription 3(STAT3) gene significantly
affected goat growth traits, Small Ruminant Res., 129, 25–36, 2015.Jin, Y., Cai, H., Liu, J., Lin, F., Qi, X., Bai, Y., Lei, C., Chen, H., and
Lan, X.: The 10 bp duplication insertion/deletion in the promoter region
within paired box 7 gene is associated with growth traits in cattle, Arch.
Anim. Breed., 59, 469–476, 10.5194/aab-59-469-2016, 2016.Jing, Y. J., Lan, X. Y., Chen, H., Zhang, L. Z., Zhang, C. L., Pan, C. Y.,
Li, M. J., Ren, G., Wei, T. B., and Zhao, M.: Three novel single-nucleotide
polymorphisms of the bovine LHX3 gene, J. Biosci. Bioeng., 33,
673–679, 2008.
Lan, X. Y., Pan, C. Y., Chen, H., Zhang, C. L., Li, J. Y., Zhao, M., Lei, C.
Z., Zhang, A. L., and Zhang, L.: An AluI PCR-RFLP detecting a silent allele
at the goat POU1F1 locus and its association with production traits, Small
Ruminant Res., 73, 8–12, 2007.
Lan, X. Y., Zhao, H. Y., Li, Z. J., Zhou, R., Pan, C. Y., Lei, C. Z., and
Chen, H.: Exploring the Novel Genetic Variant of PITX1 Gene and Its Effect on
Milk Performance in Dairy Goats, J. Intgr. Agr., 12, 118–126, 2013.
Li, Z. Q., Zhang, Z., He, Z., Tang, W., Li, T., Zeng, Z., He, L., and Shi, Y.
Y.: A partition- ligation- combination- subdivision EM algorithm for
haplotype inference with multiallelic markers: update of the SHE sis, Cell
Res., 19, 519–523, 2009.Liu, J. B., Lan, X. Y., Xu, Y., Li, Z. J., Lei, C. Z., and Chen, H.: Combined
effects of three novel SNPs within goat LHX3 gene on milk
performance, Genes. Genom., 33, 549–556, 2011.
Lyu, S. J., Tian, Y. D., Wang, S. H., Han, R. L., Mei, X. X., and Kang, X.
T.: A novel 2 bp indel within Krüppel-like factor 15 gene (KLF15) and
its associations with chicken growth and carcass traits, Br. Poult. Sci., 55,
427–434, 2014.Malik, R. E. and Rhodes, S. J.: The role of DNA methylation in regulation of
the murine LHX3 gene, Gene, 25, 272-281, 2014.
Miao, X. and Qin, Q. L.: Genome-wide transcriptome analysis of mRNAs and
microRNAs in Dorset and Small Tail Han sheep to explore the regulation of
fecundity, Mol. Cell. Endocrinol., 402, 32–42, 2015.
Pan, C. Y., Wu, C. Y., Jia, W. C., Xu, Y., Hu, S. R., Lei, C. Z., Lan, X. Y.,
and Chen, H.: A critical functional missense mutation (H173R) in the bovine
PROP1 gene significantly affects growth traits in cattle, Gene, 531,
398–402, 2013.Park, S., Mullen, R. D., and Rhodes, S. J.: Cell-specific actions of a human
LHX3 gene enhancer during pituitary and spinal cord development,
Mol. Endocrinol., 27, 2013–2027, 2013.
Rodrigues, G. K., Resende, C. M., Durso, D. F., Rodrigues, L. A., Silva, J.
L., Reis, R. C., Pereira, S. S., Ferreira, D. C., Franco, G. R., and
Alvarez-Leite, J.: A single FTO gene variant rs9939609 is associated with
body weight evolution in a multiethnic extremely obese population that
underwent bariatric surgery, Nutrition, 3, 1344–1350, 2015.Savage, J. J., Mullen, R. D., Sloop, W. K., Colvin, S. C., Camper, S. A.,
Franklin, C. L., and Rhodes, S. J.: Transgenic mice expressing LHX3
transcription factor isoforms in the pituitary: effects on the gonadotrope
axis and sex-specific reproductive disease, J. Cell. Physiol., 212, 105–117,
2007.Seo, S. Y., Lee, B., and Lee, S.: Critical Roles of the LIM Domains of
LHX3 in Recruiting Coactivators to the Motor Neuron-Specifying
Isl1-LHX3 Complex, Mol. Biol. Cell., 35, 3579–3589, 2015.
Song, X. M., Jiang, J. F., Zhang, G. Z., Shi, F. X., and Jiang, Y. Q.: DNA
polymorphisms of the Hu sheep melanocortin-4 receptor gene associated with
birth weight and 45-day weaning weight, Genet. Mol. Res., 11, 4432–4441,
2012.
Tepaamorndech, S., Kirschke, C. P., and Huang, L.: Linking cellular zinc
status to body weight and fat mass: mapping quantitative trait loci in Znt7
knockout mice, Mamm. Genome., 25, 335–353,
2014.
Tian, D. C., Wang, Q., Zhang, P. F., Araki, H., Yang, S. H., Kreitman, M.,
Nagylaki, T., Hudson, R., Bergelson, J., and Chen, J. Q.: Single-nucleotide
mutation rate increases close to insertions/deletions in eukaryotes, Nature,
455, 105–109, 2008.Voorbij, A. M., Van Meij, B. P., Bruggen, L. W., Grinwis, G. C., Stassen, Q.
E., and Kooistra, H. S.: Atlanto-axial malformation and instability in dogs
with pituitary dwarfism due to an LHX3 mutation, J. Vet. Intern.
Med., 29, 207–213, 2015.
Williams, L. E. and Wernegreen, J. J.: Sequence context of indel mutations
and their effect on protein evolution in a bacterial endosymbiont, Genome
Bio. Evol., 5, 599–605, 2013.
Yang, Q., Zhang, S. H., Liu, L., Cao, X., Lei, C. C., Qi, X., Lin, F., Qu,
W., Qi, X., Liu, J., Wang, R., Chen, H., and Lan, X. Y.: Application of
mathematical expectation (ME) strategy for detecting low frequency mutations:
An example for evaluating 14 bp insertion/deletion (indel) within the bovine
PRNP gene, Prion, 10, 409–419, 2016.Yoshida, S., Kato, T., Nishimura, N., Kanno, N., Chen, M., Ueharu, H.,
Nishihara, H., and Kato, Y.: Transcription of follicle-stimulating hormone
subunit genes is modulated by porcine LIM homeobox transcription factors,
LHX2 and LHX3, J. Reprod. Develop., 62, 241–248, 2016.
Zhang, Z., Xu, F., Zhang, Y., Li, W., Yin, Y., Zhu, C., Du, L., Elsayed, A.
K., and Li, B.: Cloning and expression of MyoG gene from Hu sheep and
identification of its myogenic specificity, Mol. Biol. Rep., 41, 1003–1013,
2014.
Zhang, S. H., Sun, K. A., Bian, Y. N., Zhao, Q., Wang, Z., Ji, C. N., and Li,
C. T.: Developmental validation of an X-Insertion/Deletion polymorphism panel
and application in HAN population of China, Sci. Rep., 5, 1833–1836, 2015a.
Zhang, X. Y., Wu, X. F., Jia, W. C., Pan, C. Y., Li, X. C., Lei, C. Z., Chen,
H., and Lan, X. Y.: Novel Nucleotide Variations, Haplotypes Structure and
Associations with Growth Related Traits of Goat AT Motif-Binding Factor
(ATBF1) Gene, J. Anim. Sci., 28, 1394–1406, 2015b.Zhang, M., Pan, C., Lin, Q., Hu, S., Dang, R., Lei, C., Chen, H., and Lan,
X.: Exploration of the exonic variations of the iPSC-related Nanog
gene and their effects on phenotypic traits in cattle, Arch. Anim. Breed.,
59, 351–361, 10.5194/aab-59-351-2016, 2016.