Journal cover Journal topic
Archives Animal Breeding Archiv Tierzucht

Journal metrics

  • IF value: 0.389 IF 0.389
  • IF 5-year<br/> value: 0.500 IF 5-year
    0.500
  • CiteScore<br/> value: 0.59 CiteScore
    0.59
  • SNIP value: 0.685 SNIP 0.685
  • SJR value: 0.353 SJR 0.353
  • IPP value: 0.657 IPP 0.657
  • h5-index value: 9 h5-index 9
Supported by
Logo Leibniz Institute for Farm Animal Biology
Logo Leibniz Association
Arch. Anim. Breed., 60, 79-85, 2017
http://www.arch-anim-breed.net/60/79/2017/
doi:10.5194/aab-60-79-2017
© Author(s) 2017. This work is distributed
under the Creative Commons Attribution 3.0 License.
Original study
27 Apr 2017
A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its influence on growth traits in four sheep breeds of various fecundity
Haidong Zhao1, Shuai He1, Yanjiao Zhu1, Xin Cao2,4, Renyun Luo3, Yong Cai2,4, Hongwei Xu2,4, and Xiuzhu Sun1 1College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China
2Science Experimental Center, Northwest University for Nationalities, Lanzhou, Gansu, 730030, P. R. China
3Ruilin Sci-Tech Culture and Breeding Limit Company, Yongjing, Gansu, 731600, P. R. China
4College of Life Science and Engineering, Northwest University for Nationalities, Lanzhou, Gansu, 730030, P. R. China
Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P < 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P < 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.

Citation: Zhao, H., He, S., Zhu, Y., Cao, X., Luo, R., Cai, Y., Xu, H., and Sun, X.: A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its influence on growth traits in four sheep breeds of various fecundity, Arch. Anim. Breed., 60, 79-85, doi:10.5194/aab-60-79-2017, 2017.
Download
Short summary
The 29 bp indel of sheep LHX3 gene was firstly verified in four Chinese indigenous sheep breeds of various fecundity. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (Hu sheep, HS; small-tail Han sheep, STHS; and Lanzhou fat-tail sheep, LFTS) and the low-fecundity breed (Tong sheep (TS)) based on an χ2 test (P < 0.05). Moreover, four significant differences were found in body length and chest width in TS and STHS (P < 0.05).
The 29 bp indel of sheep LHX3 gene was firstly verified in four Chinese indigenous sheep breeds...
Share